• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Biotechnological production of D-Diboa and its chlorinated derivatives from its nitrophenoxide-acetate precursors. The scientific area to which the invention corresponds is biotechnology, since it is the optimization of a biotechnological process to produce a compound with potential use as a herbicide, insecticide, fungicide and/or bactericide. For this reason, the industrial sector of application is the agrochemical sector that directs its efforts towards the search for new, more selective and active phytochemical compounds that are also respectful with the environment. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2772598A1
    申请号:ES201831274
    申请日:2018-12-21
    公开日:2020-07-07
    发明作者:Moreno Domingo Cantero；Perez Jorge Bolivar；Revuelta Gema Cabrera；Gallardo Antonio Valle；La Calle Sierra Maria Elena De
    申请人:Universidad de Cadiz；
    IPC主号:
    专利说明:

    [0002] BIOTECHNOLOGICAL PRODUCTION OF D-DIBOA AND ITS CHLORINE DERIVATIVES FROM ITS NITROPHENOXIDE-ACETATE PRECURSORS
    [0004] TECHNICAL SECTOR
    [0006] The scientific area to which the invention corresponds is biotechnology, since it involves optimizing a biotechnological process to produce a compound with potential use as a herbicide, insecticide, fungicide and / or bactericide. For this reason, the industrial sector of application is the agrochemical sector that directs its efforts towards the search for new, more selective and active phytochemical compounds that are also respectful with the environment.
    [0008] STATE OF THE ART
    [0010] The invention for the biotechnological production of D-DIBOA, a compound with potential application as a herbicide, insecticide, fungicide and / or bactericide using a genetically modified strain of the bacterium Eschenchia coli, is a process that unifies, on the one hand, the synthesis of a compound biologically active that does not have negative impacts on the environment and, on the other, the use of this genetically modified strain to carry out the biological process with high yields.
    [0012] Herbicides have traditionally been used to increase agricultural production with increased yields and food security. Currently, the use of synthetic herbicides is the most effective strategy to reduce and control both the growth and spread of weeds. However, its indiscriminate use has caused a strong environmental and ecological impact (Cordeau et al., 2016). Thus, problems such as contamination, bioaccumulation and the appearance of resistance phenomena have been attributed to the effect of herbicides. This fact has promoted research focused on finding new formulas that are, mainly, more respectful with the environment and that, in addition, present new modes of action for which, therefore, resistance phenomena have not been described.
    [0013] To reduce dependence on chemical control and mitigate the negative impacts that herbicides have on the environment, the strategy of using natural products with similar properties is increasingly accepted in the agricultural sector (Muzell Trezzi et al., 2016). One of the most interesting alternatives to these synthetic herbicides is the use of plant allelochemicals. These are products that plants naturally synthesize and that affect the survival or growth of other organisms, be they plants, insects, microorganisms or fungi (Rimando and Duke, 2006). Due to their structural diversity, specific mode of action and degradability in the soil, allelochemicals have been proposed as new models of effective herbicides to control pest management in agricultural crops (Macías et al., 2009).
    [0015] Within these compounds, alkaloids, secondary metabolites synthesized from amino acids, have aroused special interest because they have been identified as pharmacologically active basic compounds (Tiwari and Rana, 2015). Among them, hydroxamic acids stand out for being emitted by various crops of great importance from the agri-food point of view. Thus, the species of the Poaceae family (grasses) such as Zea mays L. (corn), Triticum aestivum L. (wheat) and Hordeum vulgare L. (barley) present numerous antecedents as plants with allelopathic activity, which has been attributed to the exudation and incorporation into the soil of these hydroxamic acids.
    [0017] Cyclic hydroxamic acids, known as benzohydroxamic acids (Figure 1), act by providing protection to a multitude of species of the Poaceae family, including such important agricultural crops as corn, wheat or rye ( Secale cereale L.) (Frey et al. , 2009). Specifically, DIBOA (2,4-dihydroxy- (2H) -1,4-benzoxacin-3 (4H) -one) (Figure 2) is the benzohydroxamic acid that has aroused the greatest interest due to its high phytotoxicity, high specificity and high degradability in the soil. It was isolated for the first time from rye roots in 1959. The phytotoxic activity of DIBOA and the products related to its degradation in the soil, has been tested both in model species of phytotoxic studies and in species that cause problems in agricultural crops. (weeds), proving that this compound is not only comparable with that of some commercial synthetic herbicides, but even improves them in some cases (Macías et al., 2006b, 2005).
    [0018] Despite the success of the isolation of DIBOA from plants, its synthesis is conditioned by external factors and, in addition, it is limited to small amounts that do not make its extraction, production and application on a larger scale feasible. Therefore, many studies have been focused on the chemical synthesis of these compounds.
    [0020] The chemical synthesis of a large number of compounds with a backbone (2H) -1,4-benzoxacin-3 (4H) -one (I) has been carried out through a reductive cyclization methodology initially reported by Coutts (1963) ( Atkinson et al., 1991). Later, this reaction was used to patent a process for the chemical synthesis of DIBOA (II) , and other benzohydroxamic acids, from 2-nitrophenol or derivatives (Jernow and Rosen, 1975) (Figure 3). In a first reaction, 2-nitrophenoxide (III) undergoes a nucleophilic substitution at C-2, giving rise to a methyl 2-nitrophenoxyacetate compound (IV) . Subsequently, the reductive cyclization of this intermediate compound produces the corresponding benzohydroxamic acid (V) , however, this compound still has to undergo different radical modifications to finally obtain DIBOA.
    [0022] In that same year, an alternative process for the chemical synthesis of DIBOA using zinc chelators was patented (Tipton and Tsao, 1975) (Figure 4), with a foundation similar to the previous one. In this case, the invention is based in a concrete way on the chemical synthesis of DIBOA from 2-nitrophenol (VI) , which reacts with an alkyl chlorofluoroacetate (VII) under ambient conditions to give rise to the intermediate compound 2- nitrophenoxy-fluoro-alkyl acetate (VIII) . The reductive cyclization reaction originates from reacting this intermediate compound in aqueous solution with zinc and ammonium chloride to produce the zinc chelate DIBOA (IX) . If this complex is reacted with excess EDTA, complete conversion of the zinc chelate to free DIBOA is ensured.
    [0024] Recently, it has been possible to chemically synthesize the deoxy forms of the 2,4-dihydroxybenzoxacinones using the same synthesis basis as in the previous cases, obtaining in this case 4-hydroxybenzoxacinones and, in particular, 4-hydroxy- (2H ) -1,4-benzoxacin-3- (4H) -one (D-DIBOA) (X) (Figure 5). Macías et al. Patented (2008) (WO 2008/012385 Al) a set of chemical methods to synthesize various halogenated derivatives of D-DIBOA, among them 6-Cl-4-hydroxy- (2H) -1,4-benzoxacin. -3- (4H) -one (6-Cl-D-DIBOA) ( XI ) (Figure 5) and 8-Cl-4-hydroxy- (2H) -1,4-benzoxacin-3- (4H) -one (8-Cl-D-DIBOA) ( XII ) (Figure 5) that are characterized by presenting higher phytotoxic activity and high selectivity, respectively. Previously, they had reported the synthesis of D-DIBOA in two stages analogous to those previously described. In this specific case, the first stage uses 2-nitrophenol (VI) and ethyl bromoacetate as the starting material, obtaining the intermediate compound 2- (2'-nitrophenoxy) -ethyl acetate (XII) (hereinafter called precursor ) with a yield of 99%. In the second stage, the reductive cyclization of this compound gives rise to D-DIBOA (X) with a yield of 70% (Macías et al., 2006a, 2006c) (Figure 6).
    [0026] Phytotoxicity studies demonstrated that the D-DIBOA form has greater biological activity than its DIBOA analog (Macías et al., 2005), so that the synthesis of D-DIBOA acquired greater relevance in the field of the agrochemical industry.
    [0028] However, there are two problems to be solved to achieve industrial-scale production of D-DIBOA, both related to the second stage of chemical synthesis. The first is that it is a heterogeneous exothermic catalysis reaction with evolution of hydrogen, which is associated with a high risk of explosion. These reaction conditions make the process expensive and dangerous. The second of the problems is the relatively low yield of this second stage, which causes the loss of 30% of the precursor.
    [0030] One of the greatest challenges in today's chemical industry is to work with processes in which the desired products are maximized, by-products are minimized, synthesis routes are simplified and, furthermore, low-polluting solvents are used. Based on this approach, the term "Green Chemistry" emerged (Anastas and Warner, 1998), whose objective is to promote the use of chemical processes that are environmentally and ecologically harmless (Tucker and Faul, 2016).
    [0031] Biocatalysts are considered an interesting alternative to chemical synthesis from the point of view of green chemistry. The use of enzymes as biocatalysts stand out for their selective ability to convert initially inexpensive compounds into complex molecules, all in an acoustic medium and under milder reaction conditions than chemical reactions (Hammer et al., 2017) . The use of enzymes as catalysts in chemical synthesis processes has a growing acceptance, since biocatalysis gives rise to extremely high reaction rates that go beyond those obtained in chemical catalysis and with a much higher substrate binding specificity than chemical catalysts (Koeller and Wong, 2001). This is due to the development of recombinant protein production technology, which allows the production of biocatalysts in a fast and economical way by overexpression of the enzyme of interest. Once overexpressed, the enzymes can be used within the cell, functioning as a catalyst (cellular biocatalyst or wholecell-biocatalyst) or they can be purified for use in vitro (de Carvalho, 2011; Wachtmeister and Rother, 2016).
    [0033] The possibility of the production of D-DIBOA by means of a cellular biocatalysis of the precursor, from the Bacternia species Escherichia coli and Serratia marcescens, was explored by Valle et al. (2011). This work represented a great advance in the biotechnological field, since it demonstrated that E. coli is capable of biotransforming the precursor into D-DIBOA using a complex culture medium (LB medium). However, the performance of this process was very low, reaching a maximum of 20%.
    [0035] A later study by the same group identified the enzymes responsible for the biotransformation process in E. coli , concluding that type I oxygen-insensitive nitroreductases, NfsA and NfsB, are those that perform the enzymatic catalysis that leads to the synthesis of D-DIBOA since the mutation of the genes that express these proteins annulled the synthesis of D-DIBOA (Valle et al., 2012). In addition, the cloning of the nfsA or nfsB genes (which express the enzymes NfsA and NfsB, respectively) in the inducible expression vector pBAD, caused these mutants to not only recover the 20% yield of the wild strain but also gave rise to at a considerable increase. Among the phenotypes analyzed in this work, the E. coli strain nfsB '/ pBAD-NfsB was identified, which presented the deletion of the nfsB gene and its subsequent complementation with the vector pBAD-NfsB, as the one with the best molar performance. in the biotransformation process, with a 60% conversion of the precursor to D-DIBOA. The conditions under which the biological stage takes place are gentler and more environmentally friendly than the chemical stage, which facilitates scaling up of synthesis. However, biotransformation with this strain of E. coli did not solve the second problem to address the scaling of D-DIBOA production, that is, not only did it not improve the yield of the chemical process (70%) but it was lower ( 60%). Therefore, increasing performance is the challenge that would be necessary to address so that the synthesis of this interesting compound can be produced on a large scale.
    [0037] Bibliographic references:
    [0039] Anastas, P.T., Warner, J.C., 1998. Green chemistry: theory and practice. Oxford University Press.
    [0041] Atkinson, J., Morand, P., Arnason +, J.T., Niemeyer, H.M., Bravo, H.R., 1991.
    [0042] Analogues of the cyclic hydroxamic acid 2,4-Dihydroxy-7-methoxy-2H-1,4-benzoxazin-3-one: Decomposition to Benzoxazolinones and Reaction with p-Mercaptoethanol, J. Org. Chem. UTC.
    [0044] Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, KA, Tomita, M., Wanner, BL, Mori, H., 2006. Construction of Escherichia coli K-12 inframe, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006.0008. https://doi.org/10.1038/msb4100050
    [0046] Cordeau, S., Triolet, M., Wayman, S., Steinberg, C., Guillemin, J.-P., 2016.
    [0047] Bioherbicides: Dead in the water A review of the existing products for integrated weed management. Crop Prot. 87, 44-49. https://doi.org/10.10167j.cropro.2016.04.016
    [0049] Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640-5. https://doi.org/10.1073/pnas.120163297
    [0051] de Carvalho, C., 2011. Enzymatic and whole cell catalysis: Finding new strategies for old processes. Biotechnol. Adv. 29, 75-83. https://doi.org/10.1016ZJ.BI0TECHADV.2010.09.001
    [0053] Frey, M., Schullehner, K., Dick, R., Fiesselmann, A., Gierl, A., 2009. Benzoxazinoid biosynthesis, a model for evolution of secondary metabolic pathways in plants. Phytochemistry 70, 1645-1651. https://doi.org/10.1016/JPHYT0CHEM.2009.05.012
    [0055] Green, MR, Sambrook, J., 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press. https://doi.org/10.1086/394015
    [0056] Hammer, S.C., Knight, A.M., Arnold, F.H., 2017. Design and evolution of enzymes for non-natural chemistry. Curr. Opin. Green Sustain. Chem. 7, 23-30. https://doi.org/10.1016/J.COGSC.2017.06.002
    [0058] Jernow, J .., Rosen, P., 1975. 2h-1,4-benzoxazin-3 (4h) -ones.
    [0060] Koeller, K.M., Wong, C.-H., 2001. Enzymes for chemical synthesis. Nature 409, 232 240. https://doi.org/10.1038/35051706
    [0062] Macías, F.A., De Siqueira, J.M., Chinchilla, N., Marín, D., Varela, R.M., Molinillo, J.M.G., 2006a. New herbicide models from benzoxazinones: Aromatic ring functionalization effects. J. Agric. Food Chem. 54, 9843-9851. https://doi.org/10.1021/jf062709g
    [0064] Macías, FA, Marín, D., Oliveros-Bastidas, A., Castellano, D., M. Simonet, A., Molinillo, JMG, 2005. Structure-Activity Relationships (SAR) studies of benzoxazinones, their degradation products and analogues . Phytotoxicity on standard target species (STS). J. Agric. Food Chem. 53, 538-548. https://doi.org/10.1021/JF0484071
    [0066] Macías, F.A., Marín, D., Oliveros-Bastidas, A., Castellano, D., Simonet, A.M., Molinillo, J.M.G., 2006b. Structure-Activity Relationship (SAR) Studies of benzoxazinones, their degradation products, and analogues. Phytotoxicity on problematic weeds Avena fatua L. and Lolium rigidum Gaud. J. Agric. Food Chem. 54, 1040-1048. https://doi.org/10.1021/jf050903h
    [0068] Macías, F.A., Marín, D., Oliveros-Bastidas, A., Molinillo, J.M.G., 2009. Rediscovering the bioactivity and ecological role of 1,4-benzoxazinones. Nat. Prod. Rep. 26, 478 89. https://doi.org/10.1039/b700682a
    [0070] Macías, F.A., Marín, D., Oliveros-Bastidas, A., Molinillo, J.M.G., 2006c. Optimization of Benzoxazinones as Natural Herbicide Models by Lipophilicity Enhancement. J. Agric. Food Chem. 54, 9357-9365. https://doi.org/10.1021/jf062168v
    [0071] Macías, F.A., Molinilo, J.M., Varela, R.M., Chinchilla, N., De Siqueira, J.M., Marín, D., 2008. Halogenated derivatives of benzoxazinones, with phytotoxic activity.
    [0073] Muzell Trezzi, M., Vidal, RA, Balbinot Junior, AA, von Hertwig Bittencourt, H., da Silva Souza Filho, AP, 2016. Allelopathy: driving mechanisms governing its activity in agriculture. J. Plant Interact. 11, 53-60. https://doi.org/10.1080/17429145.2016.1159342
    [0075] Rimando, A.M., Duke, S.O., 2006. Natural Products for Pest Management. American Chemical Society, pp. 2-21. https://doi.org/10.1021/bk-2006-0927.ch001
    [0076] Tipton, C.L., Tsao, F.H.-C., 1975. Zincchelate of 2,4-dihydroxy-1,4 (2H) -benzoxazine-3-one.
    [0078] Tiwari, R., Rana, C., 2015. Plant secundary metabolites: a review. Int. J. Eng. Res.
    [0079] Gen. Sci. 3.
    [0081] Tucker, J.L., Faul, M.M., 2016. Drug companies must adopt green chemistry. Nature 534, 27-29. https://doi.org/10.1038/534027a
    [0083] Valle, A., Cabrera, G., Molinillo, J.M.G., Gómez, J.M., MacÍas, F.A., Cantero, D., 2011.
    [0084] Biotransformation of ethyl 2- (2'-nitrophenoxy) acetate to benzohydroxamic acid (D-DIBOA) by Escherichia coli. Process Biochem. 46, 358-364. https://doi.org/10.1016/j.procbio.2010.09.011
    [0086] Valle, A., Le Borgne, S., Bolívar, J., Cabrera, G., Cantero, D., 2012. Study of the role played by NfsA, NfsB nitroreductase and NemA flavin reductase from Escherichia coli in the conversion of ethyl 2- (2'- nitrophenoxy) acetate to 4-hydroxy- (2H) -1,4-benzoxazin-3 (4H) -one (D-DIBOA), a benzohydroxamic acid with interesting biol. Appl. Microbiol. Biotechnol. 94, 163-171. https://doi.org/10.1007/s00253-011-3787-0
    [0088] Wachtmeister, J., Rother, D., 2016. Recent advances in whole cell biocatalysis techniques bridging from investigative to industrial scale. Curr. Opin. Biotechnol.
    [0089] 42, 169-177. https://doi.org/10.1016/j.copbio.2016.05.005
    [0091] BRIEF DESCRIPTION OF THE INVENTION
    [0093] In a first aspect, the present invention refers to a bacterial strain belonging to the species E. coli characterized in that said strain has the lapA gene and / or the fliQ gene functionally or completely or partially inactivated eliminated, because said strain overexpressed the NfsB enzyme gene, and because said strain is capable of producing D-DIBOA, 6-Cl-D-DIBOA or 8-Cl-D-DIBOA, respectively, from its precursor 2- Ethyl (2'-nitrophenoxy) -acetate, ethyl 4-Cl-2- (2'-nitrophenoxy) -acetate, or ethyl 6-Cl-2- (2'-nitrophenoxy) -acetate. Preferably, said strain is strain BW25113. More preferably, said strain has the lapA gene and the fliQ gene functionally inactivated or completely or partially deleted. Even more preferably, said strain corresponds to the strain deposited with the Spanish Collection of Type Cultures (CECT) on 11/14/2018, with access number CECT 9760.
    [0095] A second aspect of the invention refers to the in vitro use of the bacterial strain as defined in the first aspect of the invention, for the production of D-DIBOA from its precursor 2- (2'-nitrophenoxy )-ethyl acetate. Preferably, said production is carried out in the minimal culture medium comprising: MgSO4; CaCl2; Na2HPO4; KH2PO4; NaCl; NH4Cl; and glucose. More preferably, said production is carried out in the minimum culture medium comprising: 0.24 g / L MgSO4; 0.01 g / L CaCl2; 11.12 g / L Na2HPO4; 3 g / L KH2PO4; 0.5 g / L NaCl; 1 g / L NH4Cl; 4 g / L glucose. Even more preferably, said production is carried out according to the method described in example 1 or 2.
    [0097] A third aspect of the invention refers to the in vitro use of the bacterial strain as defined in the first aspect of the invention, for the production of 6-Cl-D-DIBOA from its precursor 4-Cl Ethyl -2- (2'-nitrophenoxy) -acetate.
    [0099] A fourth aspect of the invention refers to the in vitro use of the bacterial strain as defined in the first aspect of the invention, for the production of 8-Cl-D-DIBOA from its precursor 6-Cl Ethyl -2- (2'-nitrophenoxy) -acetate.
    [0101] A fifth aspect of the invention refers to a culture medium comprising: 0.24 g / L MgSO4; 0.01 g / L CaCl2; 11.12 g / L Na2HPO4; 3 g / L KH2PO4; 0.5 g / L NaCl; 1 g / L NH4Cl; 4 g / L glucose. Preferably, said culture medium of the fifth aspect of the invention is used for the production of D-DIBOA from its precursor ethyl 2- (2'-nitrophenoxy) -acetate. More preferably, said culture medium is used for production with a bacterial strain belonging to the species E. coli characterized in that said strain overexpress the gene for the NfsB enzyme. Even more preferably, said bacterial strain is characterized in that said strain presents the lapA gene and the fliQ gene functionally inactivated or completely or partially deleted, and that said strain overexpress the gene for the NfsB enzyme.
    [0103] A sixth aspect of the invention refers to the procedure for the biological synthesis of D-DIBOA using as a biocatalyst the E. coli strain according to any one of claims 1 to 4, using ethyl 2- (2'-nitrophenoxy) -acetate as precursor , where said procedure comprises the following stages:
    [0105] to. Cultivate the E. coli strain in the culture medium defined in any one of claims 6 or 7;
    [0107] b. Induce the bacterium for the expression of the NfsB protein;
    [0109] c. Add the precursor 2- (2'-nitrophenoxy) -acetate ethyl;
    [0111] d. Optionally, add new batches of substrate in the culture medium at different times of biotransformation to obtain higher yields and / or concentrations of the product.
    [0113] A seventh aspect of the invention relates to the process of synthesis of D-DIBOA by an alternative strategy of biocatalysis using the enzyme NfsB purified in a chemical reaction, preferably with a phosphate buffered medium and adding the reducing cofactor NADH, more preferably using a procedure as described in example 4.
    [0115] An eighth aspect of the invention refers to the process for the synthesis of 6-Cl-D-DIBOA by an alternative biocatalysis strategy using the purified NfsB enzyme in a chemical reaction, preferably with a phosphate buffered medium and adding the reduction cofactor NADH , more preferably using the procedure described in Example 5.
    [0117] A ninth aspect of the invention refers to the process of synthesis of 8-Cl-D-DIBOA by an alternative biocatalysis strategy using the purified NfsB enzyme in a chemical reaction, preferably with a phosphate buffered medium and adding the reduction cofactor NADH , more preferably using the procedure described in Example 6.
    [0118] DETAILED DESCRIPTION OF THE INVENTION
    [0120] Taking into account the state of the art, the need to find new strains, methodologies and / or culture conditions that improve the performance of biotransformation is of special interest for the biotechnological production of D-DIBOA.
    [0122] This invention describes the methodology for optimizing the biological synthesis of D-DIBOA from its chemical precursor, 2- (2'-nitrophenoxy) -acetate ethyl. For this, two biocatalytic methodologies are described: the first one consists of a cellular biocatalysis, in which living E. coli cells with an appropriate genetic background are used as catalysts in which the NfsB enzyme is overexpressed and which act as factories. D-DIBOA-producing cell phones. The second is a purified enzyme biocatalysis, in which the NfsB enzyme produced by recombinant DNA technology in E. coli is used, it is a process in which the redox cofactor NADH and a phosphate buffered solution are required. sodium. In this case, the use of the reduced form of the cofactor NADH makes the process more expensive, but the biotransformation is achieved faster than in cell biocatalysis.
    [0124] A) CELLULAR BIOCATALYSIS. This section describes the methodology for the use of cellular biocatalysts, using a genetically modified E. coli strain to achieve yields of up to 100% (compared to 70% for chemical synthesis and 60% for biological synthesis. previously reported) and an increase in the concentration of D-DIBOA in the culture medium of up to 379% compared to that described in the literature in biotransformation processes. In addition, this production is obtained in a defined culture medium, compared to the use of complex culture media previously reported, which will facilitate the future purification of the product. All this is carried out under mild and environmentally friendly conditions, since the process is carried out in an aqueous medium and the use of organic solvents is minimized. The yield of the reaction, the product concentration reached and the conditions in which it is carried out make the production of D-DIBOA by means of this methodology potentially scalable, being able to produce adequate quantities for its commercial exploitation.
    [0125] The biotransformation process of D-DIBOA from the precursor is carried out in a batch system, in 250 mL Erlenmeyer flasks. Under specific conditions, the strain is used as a biocatalyst capable of biologically transforming the precursor (this being the substrate of the reaction) and converting it into D-DIBOA. As described in the state of the art, this concept was already reported by Valle et al. (2012), however, the present invention has carried out the modification of the following parameters to optimize the process:
    [0127] i. E. coli strain used in the bioprocess
    [0129] ii. Culture medium
    [0131] iii. Microbial culture growth temperature
    [0133] iv. Induction phase of enzyme expression
    [0135] v. Inoculation of the culture medium
    [0137] saw. Phase of addition of the precursor to the culture medium
    [0139] vii. Feeding mode
    [0141] (i) The E. coli strain AlapAAfl / Q :: kan / pBAD-NfsB (registration number: CECT 9760) is used to carry out the process of the present invention. This strain was constructed from the simple mutant lapA (expresses the LapA protein involved in the assembly of the cell wall lipopolysaccharide), acquired from the collection of The Coli Genetic Stock Center (CGSC). In this strain, the fliQ gene (expresses the FliQ protein involved in flagellum biosynthesis) was deleted using homologous recombination directed mutagenesis methodology (Datsenko and Wanner, 2000). The choice of these two mutations for the construction of the double mutant was the result of a previous selection work on the 3985 simple mutants that make up the Keio Collection of NAIST (Nara Institute of Science and Technology, Kyoto) (Baba et al., 2006 ), based on a rational design in which mutants that could potentially contribute greater availability of the cofactors NADH, NADPH or greater availability of metabolic resources (energy) to the biotransformation process were selected. This criterion was considered because the NfsB enzyme requires two molecules of the cofactors NADH or NADPH in their reduced form in order to carry out the reduction of the nitro group of the precursor. These cofactors pass then to its oxidized form (NAD + or NADP +), its regeneration being a limiting factor in the process (Figure 7). Specifically, those genes that could be related to metabolic pathways that require the reduction of these or other cofactors, such as certain macromolecule biosynthesis pathways, carbon utilization, intermediaries of central metabolism, energy metabolism or energy production or transport across the membrane.
    [0142] Based on the exposed criteria, 34 simple mutant strains were selected, which were modified so that they inducibly overexpress NfsB nitroreductase. Overexpression is controlled by adding the compound L -arabinose to the culture medium, since this gene was cloned in the inducible expression vector pBAD (vector pBAD-NfsB), previously constructed by the inventors. Next, the ability of each constructed strain to biotransform the precursor into D-DIBOA was tested (Figure 8). To quantify the biotransformation yields, the cells were removed by centrifugation and the culture medium was analyzed by HPLC with a C18 column according to the methodology previously developed by the group (Valle et al., 2011).
    [0143] From this study, only those mutant backgrounds that improved the yield of the wild strain (40%) above 20% were selected, with the intention of making multiple mutants that would allow increasing the yields obtained in simple mutants. The objective was to obtain a multiple mutant strain that was capable of biotransforming the precursor into D-DIBOA with yields greater than the 60% reported for biotransformation and the 70% reported for chemical synthesis. In the extensive screening carried out, 19 mutant strains improved the production of D-DIBOA compared to the reference strain, of which only 4 increased its values by 20%. On the contrary, the 15 remaining genetic backgrounds not only did not improve yields, but also presented a lower production than the reference strain (figure 8). Of the 4 strains that notably increased the yield of the reaction, the simple mutant AlapA was the one that reached the highest increases, with values that exceed those previously reported in biocatalysis and reaching yields close to the chemical process (68%). The other three mutants that also increased significantly, although to a lesser extent, the yield of the reaction were: AfliQ, AnuoG and AfadR (Figure 9). However, the AfliQ mutant showed an interesting and distinctive characteristic, since it was able to achieve high levels of biotransformation in less time than any other of the mutants tested. Since both mutants were not metabolically related, it was reasoned that a strain lacking activity for both genes could improve the favorable biotransformation characteristics of both strains, so it was decided to construct the AlapAAfliQ double mutant . To do this, a double mutant was generated from the single mutant AlapA using the methodology described by Datsenko and Wanner (2000), described in example 4.
    [0145] The AlapAAfliQ constructed strain turned out to be an optimal genetic background for the synthesis of D-DIBOA through the overexpression of the NfsB enzyme, reaching yields of 76% (Figure 10), which exceeded the yield of the chemical reaction.
    [0146] Subsequently, we proceeded to the optimization of the culture conditions, beginning with the increase in the incubation temperature from 30 ° C, previously reported in the literature, to 37 ° C, which allowed increasing the yield to 90% ( see point (iii) of the present invention (Figure 11)).
    [0148] Furthermore, as shown in the examples of the invention with this strain it has been possible to achieve 100% yields, something that has not been achieved so far neither in chemical synthesis nor in biotechnological processes. Additionally, the concentration in the culture medium has increased to 375% compared to what was previously reported in biotransformation processes.
    [0150] (ii) the Luria-Bertani (LB) complex medium was replaced by a defined minimum medium due to the greater stability that the precursor presents in this medium against LB. Taking as a basis the mineral minimum medium M9 with glucose (Green and Sambrook, 2001), a simpler culture medium was designed that will facilitate the purification process of D-DIBOA, composed of: 0.24 g / L MgSO4; 0.01 g / L CaCl2; 11.12 g / L Na2HPO4; 3 g / L KH2PO4; 0.5 g / L NaCl; 1 g / L NH4Cl; 4 g / L glucose. The LB culture medium is only used to grow the bacteria in the pre-biotransformation stages.
    [0152] (iii) The culture temperature during biotransformation is 37 ° C instead of the 30 ° C previously reported.
    [0154] (iv) Induction of the expression of the NfsB protein is carried out by adding 0.02% of L -arabinose in the pre-inoculum and maintaining this concentration throughout the process, instead of adding it to growing culture at an optical density measured at 600 nm wavelength (OD600nm) of 0.6.
    [0156] (v) The pellet resulting from the centrifugation of 10 mL of bacteria grown and induced for 12 h in modified M9 medium is resuspended in 100 mL of the same fresh medium.
    [0158] (vi) The precursor is added to the medium, at a concentration of 2.2 mM, when the culture reaches an OD600nm of 0.6 from inoculation (considered as time = 0).
    [0160] (vii) The present invention considers different times of feeding the precursor to the system. This factor leads to the development of two new D-DIBOA production strategies:
    [0162] Strategy 1 : in this strategy, a culture fed in two loading batches is proposed (adding 0.22 mmol of precursor in each one of them), one at the initial time and the other at 8 hours. The increase in the amount of precursor treated and the cultivation and operating conditions translate into an increase in the D-DIBOA concentration to 0.80 g / L, accompanied by a 100% yield in the biotransformation.
    [0164] Strategy 2: in which a culture fed in three batches is proposed (adding 0.22 mmol of precursor in each one of them), one at the initial time, at 4 and 8 hours. In this case, a maximum concentration of 0.91 g / L is achieved, however, the yield, although it improves the one achieved so far (76.2%), implies a loss of the precursor of 23.8%, with respect to the strategy one.
    [0166] Both processes have in common the early stages of the procedure. Thus, first, the LB culture medium is used to grow an inoculum of the bacteria. Once the inoculum has grown, the LB medium is removed by centrifugation and is replaced by the modified M9 mineral minimal medium, in which the biotransformation process will take place. The reagents that are necessary to add to the culture medium for the synthesis of D-DIBOA are the following:
    [0167] • Antibiotics. The strain A / apAAf // Q / pBAD-NfsB shows resistance to the antibiotics kanamycin and ampicillin, therefore, to rule out possible contamination and to avoid the loss of plasmid pBAD-NfsB, All the culture media used are supplemented with both antibiotics at a final concentration of 50 and 100 ^ g / mL, respectively.
    [0168] • L -arabinose: for the induction of the expression of the NfsB protein, 0.02% of L -arabinose is added to the culture medium.
    [0169] • Precursor: solution of precursor in methanol. In the tests carried out, a 50 mg / mL (222 mM) solution was used.
    [0171] B) BIOCATALYSIS BY MEANS OF THE PURIFIED NfsB ENZYME. As an alternative to this cellular biocatalysis, this invention proposes the production of D-DIBOA and its chlorinated derivatives, 6-Cl-D-DIBOA and 8-Cl-D-DIBOA, by means of a reaction biocatalyzed by the enzyme NfsB of E. coli. This strategy requires the purification of the enzyme, the optimization of the reaction solution, and the selection of the most suitable buffering compound, pH and redox cofactor to carry out the process. These tasks have been carried out by the inventors, as described in Examples 4, 5 and 6, Using this procedure yields of 63% are achieved in the production of D-DIBOA and for this only 210 min of reaction versus the 24 or 26 hours required for live cell strategies. Biocatalysis using the purified NfsB enzyme presented higher transformation yields for the production of chlorinated derivatives, reaching values of 81% for 6-Cl-D-DIBOA (4-Cl-2- (2'-nitrophenoxy) -acetate precursor ethyl) and 97% for 8-Cl-D-DIBOA (precursor ethyl 6-Cl-2- (2'-nitrophenoxy) -acetate) (Figures 15 and 16). In addition, the times to achieve these yields decreased to 150 min in both cases. To do this, this enzyme produced by recombinant DNA technology and purified by affinity chromatography is used as described below.
    [0173] To obtain the NfsB enzyme, the nfsB gene was cloned into the expression vector pBiEx ™ (Novagen) using the restriction enzymes HindIII (5 ') and BamHI (3'), so that it expresses the nfsB gene fused to a polyhistidine sequence. The resulting plasmid, pBiEx-NfsB, was transformed into the E. coli strain BL21 Star (Novagen) for protein production by inducing expression with IPTG (1 mM) for 4 hours from cells grown in exponential culture. Obtaining the protein extract was carried out by sonication of the biomass of bacteria induced and previously centrifuged in a 50 mM phosphate buffer (pH 7.5), verifying by western-blot, with an anti-histidine antibody, that the protein was in the soluble fraction. From said fraction, the NfsB enzyme was purified by affinity chromatography, taking advantage of the poly-histidine tail and using an affinity column with immobilized nickel ions (Ni-NTA column, GE-Healthcare). The enzyme was eluted from the column with a 0.5M imidazole solution. The imidazole was subsequently removed by dialysis against the reaction buffer.
    [0175] The purified enzyme was used as a biocatalyst for the production of D-DIBOA, 6-Cl-D-DIBOA and 8-Cl-D-DIBOA from their corresponding precursors, ethyl 2- (2'-nitrophenoxy) -acetate, Ethyl 4-Cl-2- (2'-nitrophenoxy) -acetate and ethyl 6-Cl-2- (2'-nitrophenoxy) -acetate, as indicated in Examples 4, 5 and 6, respectively.
    [0177] DESCRIPTION OF THE DRAWINGS
    [0179] Figure 1. General formula of the skeleton (2H) -1,4-benzoxacin-3 (4H) -one.
    [0181] Figure 2. DIBOA formula.
    [0183] Figure 3. Scheme of the synthesis of 2H-1,4-benzoxacin-3 (4H) -one patented by Jernow et al., 1975.
    [0185] Figure 4. Scheme of the synthesis of DIBOA zinc chelators, patented by Tipton, 1975.
    [0187] Figure 5. Formulas of the compounds synthesized in the present invention: D-DIBOA (X), 6-Cl-D-DIBOA (XI) and 8-Cl-D-DIBOA (XII).
    [0189] Figure 6. Scheme of the synthesis of D-DIBOA optimized by Macías et al. (2006). 2-nitrophenol (IV); Precursor, 2- (2'-nitrophenoxy) -acetate ethyl (XIII); D-DIBOA (X).
    [0191] Figure 7. Scheme of the reaction catalyzed by the enzyme NfsB. For the synthesis of D-DIBOA. In the synthesis of a D-DIBOA molecule, two NAD (P) H are consumed. The regeneration of this cofactor (*) is a limiting factor of the process.
    [0193] Figure 8. Screening results in the 34 selected mutants of the Keio collection. The X-axis shows biotransformation yields of the simple mutants standardized with respect to the reference strain. The black bars show the 4 mutants with the greatest increase in yield in the production of D-DIBOA (AlapA, AfliQ, AnuoG and AfadR).
    [0195] Figure 9. D-DIBOA concentration produced by the reference strain and the 4 simple mutants that biotransform the highest production of D-DIBOA.
    [0197] Figure 10. D-DIBOA concentration reached by the simple mutants AlapA and AfliQ and by the double mutant AlapAAfliQ.
    [0199] Figure 11. Effect of the increase in temperature on the production of D-DIBOA by the double mutant AlapAAfliQ .
    [0201] Figure 12. Example 1. Production of D-DIBOA using the AlapAAfliQ strain by the procedure described in example 1.
    [0203] Figure 13. Example 2. Production of D-DIBOA using the AlapAAfliQ strain by the procedure described in example 2.
    [0205] Figure 14. Example 4. Kinetics of the production of D-DIBOA from its precursor using the isolated NfsB enzyme as a biocatalyst.
    [0207] Figure 15. Example 5. Kinetics of 6-Cl-D-DIBOA production from its precursor ethyl 4-Cl-2- (2'-nitrophenoxy) -acetate using the isolated NfsB enzyme as a biocatalyst.
    [0209] Figure 16. Example 6. Kinetics of 8-Cl-D-DIBOA production from its precursor ethyl 6-Cl-2- (2'-nitrophenoxy) -acetate using the isolated NfsB enzyme as a biocatalyst.
    [0210] EXAMPLE OF A CONCRETE EMBODIMENT OF THE INVENTION
    [0212] EXAMPLE 1.
    [0214] Method to obtain a 100% biotransformation yield of D-DIBOA from the precursor.
    [0215] Next, the D-DIBOA production method is described for strategy 1 , culture fed in two batches that is carried out in the following 7 steps:
    [0217] 1. Sow 1 colony of the E. coli AlapAAfl / Q / pBAD-NfsB strain previously grown in a Petri dish in LB-agar medium in 5 mL of LB medium. Incubate 8-10 hours at 37 ° C and 200 rpm.
    [0218] 2. Centrifuge the culture for 10 minutes, 3,000 xg. Discard the supernatant.
    [0219] 3. Resuspend the biomass in 100 mL of modified M9 minimal medium. Induce with L -arabinose (0.02%) and incubate for 8-10 h at 37 ° C and 200 rpm.
    [0220] 4. Centrifuge 10 mL of the culture for 10 minutes, 3,000 x g. Discard the supernatant and resuspend the biomass in 100 mL of modified M9 minimal medium supplemented with L- arabinose (0.02%) in a 250 mL Erlenmeyer flask.
    [0221] 5. Incubate at 37 ° C and 200 rpm until the OD600nm of the culture is 0.6. Add 1 mL of the precursor stock, which contains 0.22 mmol.
    [0222] 6. Incubate at 37 ° C and 200 rpm for 8 hours and add 1 mL of the precursor stock again, which contains 0.22 mmol.
    [0223] 7. Incubate at 37 ° C and 200 rpm for a further 14 hours.
    [0225] At the end of this procedure, a culture volume of 100 mL is obtained, in which a total of 4.4 mM of precursor has been added. With the biotransformation yield being 100%, and since the precursor: D-DIBOA molar ratio is 1: 1, 4.4 mM D-DIBOA (0.8 g / L) are obtained (Figure 12).
    [0227] EXAMPLE 2.
    [0229] Method to obtain a D-DIBOA concentration of 379% with respect to that reported in the state of the art.
    [0230] The procedure of strategy 2 is similar to the previous one, but with a feeding in three batches, it consists of 8 steps of which the first 5 coincide with those of steps 1-5 of strategy 1:
    [0232] 1. Sow 1 colony of the E. coli AlapAAfl / Q / pBAD-NfsB strain grown in a Petri dish on LB-agar medium in 5 mL of LB medium. Incubate 8-10 hours at 37 ° C and 200 rpm.
    [0233] 2. Centrifuge the culture for 10 minutes, 3,000 xg. Discard the supernatant.
    [0234] 3. Resuspend the biomass in 100 mL of the modified M9 minimal medium. Induce with L- arabinose and incubate for 8-10 hours at 37 ° C and 200 rpm.
    [0235] 4. Centrifuge 10 mL of the culture for 10 minutes, 3,000 xg. Discard the supernatant and resuspend the biomass in 100 mL of modified M9 minimal medium supplemented with L- arabinose in a 250 mL Erlenmeyer flask.
    [0236] 5. Incubate at 37 ° C and 200 rpm until the OD600nm of the culture is 0.6. Add 1 mL of the precursor stock, which contains 0.22 mmol.
    [0237] 6. Incubate at 37 ° C and 200 rpm for 4 hours and add 1 mL of the precursor stock, which contains 0.22 mmol.
    [0238] 7. Incubate at 37 ° C and 200 rpm for the next 4 hours and add 1 mL of the precursor stock, which contains 0.22 mmol.
    [0239] 8. Incubate at 37 ° C and 200 rpm for a further 14 hours.
    [0241] In this case, at the end of the procedure, a culture volume of 100 mL is obtained, in which a total of 6.6 mM of precursor has been added, and since the yield is 76.2%, a final concentration results of D-DIBOA of 5.05 mM (0.91 g / L) of D-DIBOA, being the highest concentration reached (Figure 13).
    [0243] EXAMPLE 3.
    [0245] Construction of the double mutant strain A lap A fliQ
    [0246] The homologous recombination mutagenesis methodology described by Datsenko and Wanner (2000) was used for the construction of the double mutant. In a first step, the kanamycin cassette / marker inserted in the simple mutant AlapA (AlapA :: kan) was eliminated by transformation with the plasmid pCP20 (which has the resistance to chloramphenicol and ampicillin as selection markers) that allows the expression of the enzyme flipase (FLP) that recombines the FRT sequences that flank the kanamycin resistance gene, eliminating it from the bacterial genome. This plasmid was eliminated by incubation at 42 ° C, since it is heat sensitive, and the clones were selected by replica plating on LB agar plates supplemented with kanamycin or chloramphenicol, thus obtaining the AlapA strain .
    [0247] To eliminate the fliQ gene of the AlapA strain , first, the kanamycin resistance cassette was amplified by PCR from the template plasmid pKD13 using oligonucleotides that at the 3 'end contained sequences complementary to the plasmid and at the 5' end flanking homologous sequences to the fliQ gene (Table 1). In this way, a DNA fragment was generated containing the antibiotic resistance gene flanked by FRT sequences and sequences homologous to the target gene at each end. The product generated by PCR was introduced by electroporation into the AlapA mutane, previously transformed with the vector pKD46, which is coding for the Red recombination system.
    [0249] Oligonucleotide Sequence (5'-3 ')
    [0251] H1P4-fliQ TGCTGGTCGGTTCGCTGGCGCAGAGCTTTTACAGCTAGAGAGGCAAAATG
    [0252] H2P1-fliQ GTTCGCTTGTCACCTGCAACATAGTACGGCTACCCGATGATATACGGCAG
    [0253] Table 1. Oligonucleotides designed for the construction of the AlapAAfliQ double mutant.
    [0255] EXAMPLE 4 .
    [0256] Method to obtain D-DIBOA from the precursor using the isolated NfsB enzyme as a catalyst.
    [0258] This is a different procedure from the previous ones since, in this case, we work with the NfsB enzyme produced by recombinant DNA technology and purified by affinity chromatography. The tests carried out are carried out in 5 mL tubes, with a reaction volume of 4 mL. To avoid inactivation of the enzyme, during the preparation of the enzymatic reaction the temperature of the reagents is kept at 4 ° C. The reaction conditions are as follows: 50 mM phosphate buffer (NaH2PO4 + K2HPO4) at pH 7; 1 mM precursor; 1 ^ g of purified NfsB enzyme and 5 mM of NADH. The reaction is carried out at 30 ° C for 210 min. To stop the reaction, 1 M guanidine hydrochloride is added and the D-DIBOA concentration is analyzed by HPLC with a C18 column.
    [0259] In this case, a yield of 65% is achieved, which implies a D-DIBOA production of 0.65 mM (Figure 14).
    [0261] EXAMPLE 5 .
    [0263] Method to obtain 6-Cl-D-DIBOA from its precursor using the isolated NfsB enzyme as a catalyst.
    [0265] It is a process similar to the previous one, since the purified NfsB enzyme is used as a biocatalyst, although in this case the compound used as precursor and the reaction buffer in which the reaction is carried out are different. The tests carried out are carried out in 5 mL tubes, with a reaction volume of 4 mL. To avoid inactivation of the enzyme, during the preparation of the enzymatic reaction the temperature of the reagents is kept at 4 ° C. The reaction conditions are as follows: 50 mM phosphate buffer (NaH2PO4 K2HPO4) at pH 5.75; 1 mM precursor (ethyl 4-Cl-2- (2'-nitrophenoxy) -acetate); 1 ^ g of purified NfsB enzyme and 5 mM of NADH. The reaction is carried out at 30 ° C for 150 min. To stop the reaction, 1 M of guanidine hydrochloride is added and the concentration of 6-Cl-D-DIBOA and its precursor is analyzed by HPLC with a C18 column.
    [0266] In this case, a yield of 81% is achieved, which implies a D-DIBOA production of 0.81 mM (Figure 15).
    [0267] EXAMPLE 6.
    [0269] Method to obtain 8-Cl-D-DIBOA from its precursor using the isolated NfsB enzyme as a catalyst.
    [0271] In the same way as the previous examples, it is a biocatalysis in which the purified NfsB enzyme is used as a biocatalyst, using a different precursor and a different reaction buffer. The tests carried out are carried out in 5 mL tubes, with a reaction volume of 4 mL. To avoid inactivation of the enzyme, during the preparation of the enzymatic reaction the temperature of the reagents is kept at 4 ° C. The reaction conditions are as follows: 50 mM phosphate buffer (NaH2PO4 K2HPO4) at pH 6; 1 mM precursor (ethyl 6-Cl-2- (2'-nitrophenoxy) -acetate); 1 ^ g of purified NfsB enzyme and 5 mM of NADH. The reaction is carried out at 30 ° C for 150 min. To stop the reaction, 1 M of guanidine hydrochloride is added and the concentration of 6-Cl-D-DIBOA and its precursor is analyzed by HPLC with a C18 column.
    [0273] In this case, a yield of 97% is achieved, which implies a D-DIBOA production of 0.97 mM (Figure 16).
    权利要求:
    Claims (1)
    [0001]
    1. A bacterial strain belonging to the E. coli species characterized in that said strain has the lapA gene and / or the fliQ gene functionally inactivated or completely or partially eliminated, because said strain overexpresses the NfsB enzyme gene, and because said strain is capable of producing D-DIBOA, 6-Cl-D-DIBOA or 8-Cl-D-DIBOA from its precursor 2- (2'-nitrophenoxy) -acetate ethyl, 4-Cl-2- (2 Ethyl '-nitrophenoxy) -acetate, or ethyl 6-Cl-2- (2'-nitrophenoxy) -acetate.
    2. The bacterial strain according to claim 1, wherein said strain is the BW25113 strain.
    3. The bacterial strain according to any of claims 1 or 2, wherein said strain has the lapA gene and the fliQ gene functionally inactivated or completely or partially eliminated.
    4. The bacterial strain according to any of claims 1 to 3, where said strain corresponds to the strain deposited with the Spanish Collection of Type Cultures (CECT) on 11/14/2018, with access number CECT 9760.
    5. In vitro use of the bacterial strain as defined in any of claims 1 to 4, for the production of D-DIBOA from its precursor 2- (2'-nitrophenoxy) -acetic acid ethyl ester.
    6. In vitro use of the bacterial strain as defined in any of claims 1 to 4, for the production of 8-Cl-D-DIBOA from its precursor 6-Cl-2- (2'- nitrophenoxy) -ethyl acetate
    7. Use according to claim 5 wherein said production is carried out in the minimal culture medium comprising: MgSO4; CaCl2; Na2HPO4; KH2PO4; NaCl; NH4Cl; and glucose
    8. The use according to the preceding claim, wherein said production is carried out in the minimal culture medium comprising: 0.24 g / L MgSO4; 0.01 g / L CaCl2; 11.12 g / L Na2HPO4; 3 g / L KH2PO4; 0.5 g / L NaCl; 1 g / L NH4C 4 g / L glucose.
    9. Culture medium comprising: 0.24 g / L MgSO4; 0.01 g / L CaCl2; 11.12 g / L Na2HPO4; 3 g / L KH2PO4; 0.5 g / L NaCl; 1 g / L NH4C 4 g / L glucose.
    10. Use of the culture medium according to the preceding claim for the production of D-DIBOA from its precursor ethyl 2- (2'-nitrophenoxy) -acetate.
    11. Use of the culture medium according to the preceding claim, wherein said production is carried out with a bacterial strain, preferably belonging to the species E. coli, characterized in that said strain overexpresses the gene for the NfsB enzyme,
    12. Use of the culture medium according to the previous claim, where said bacterial strain is characterized in that said strain has the lapA gene and fliQ gene functionally inactivated or completely or partially eliminated, and because said strain overexpress the gene for the NfsB enzyme,
    13. Procedure for the biological synthesis of D-DIBOA using the E. coli strain as a biocatalyst according to any of claims 1 to 4 , using ethyl 2- (2'-nitrophenoxy) -acetate as a precursor, wherein said procedure comprises the following stages:
    to. Cultivate the E. coli strain in the culture medium defined in any one of claims 6 or 7;
    b. Induce the bacterium for the expression of the NfsB protein;
    c. Add the precursor 2- (2'-nitrophenoxy) -acetate ethyl;
    d. Optionally, add new batches of substrate in the culture medium at different times of biotransformation to obtain higher yields and / or concentrations of the product.
    15. The use of the purified NfsB enzyme as a catalyst for the chemical reaction for the synthesis of D-DIBOA in which the precursor ethyl 2- (2'-nitrophenoxy) -acetate is used as a substrate and NADH in its reduced form as an agent reducer.
    16. The use of the purified NfsB enzyme as a catalyst for the 6-Cl-D-DIBOA synthesis chemical reaction in which the precursor ethyl 4-Cl-2- (2'-nitrophenoxy) -acetate is used as substrate and NADH in its reduced form as a reducing agent.
    17. The use of the purified NfsB enzyme as a catalyst for the chemical reaction of synthesis of 8-Cl-D-DIBOA in which the precursor 6-Cl-2- (2'-nitrophenoxy) -acetate of ethyl is used as substrate and NADH in its reduced form as a reducing agent.
    类似技术:
    公开号 | 公开日 | 专利标题
    Settembre et al.2003|Structural and mechanistic studies on ThiO, a glycine oxidase essential for thiamin biosynthesis in Bacillus subtilis
    KR101814888B1|2018-01-04|5-aminolevulinic acid high-yield bacterial strain, preparation method and uses thereof
    ES2642795T3|2017-11-20|Recombinant bacteria and their uses to produce ethanol
    CN109072207A|2018-12-21|Improved method for modifying target nucleic acid
    Miller et al.2016|Lack of overt genome reduction in the bryostatin-producing bryozoan symbiont “Candidatus Endobugula sertula”
    EA014228B1|2010-10-29|Modified microorganisms geobacillus thermoglucosidasius with inactivated lactate dehydrogenase gene and use thereof in the production of ethanol
    JP6346673B2|2018-06-20|Recombinant microorganism expressing avermectin analog and use thereof
    CN106047916A|2016-10-26|Corynebacterium glutamicum strain for production of 5-aminolevulinic acid and construction and application of corynebacterium glutamicum strain
    CN104004701A|2014-08-27|Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains
    Changko et al.2020|The phosphite oxidoreductase gene, ptxD as a bio-contained chloroplast marker and crop-protection tool for algal biotechnology using Chlamydomonas
    Tanwar et al.2018|Targeted genome editing in algae using CRISPR/Cas9
    ES2772598B2|2021-04-12|BIOTECHNOLOGICAL PRODUCTION OF D-DIBOA AND ITS CHLORINE DERIVATIVES FROM ITS NITROPHENOXIDE-ACETATE PRECURSORS
    CN110325641A|2019-10-11|The Cell free expression system of energy regeneration based on inorganic polyphosphate
    EA013467B1|2010-04-30|Method for culturing microorganisms
    ES2741637T3|2020-02-11|Highly producing isopropyl alcohol producing bacteria
    Schmitz et al.2019|Improved electrocompetence and metabolic engineering of Clostridium pasteurianum reveals a new regulation pattern of glycerol fermentation
    de la Calle et al.2019|A genetically engineered Escherichia coli strain overexpressing the nitroreductase NfsB is capable of producing the herbicide D-DIBOA with 100% molar yield
    WO2021036901A1|2021-03-04|APPLICATION OF BRANCHED-CHAIN α-KETOACID DEHYDROGENASE COMPLEX IN PREPARATION OF MALONYL COENZYME A
    US10351885B2|2019-07-16|Variant microorganism producing 5-aminolevulinic acid and method for preparing 5-aminolevulinic acid using therof
    US9932608B2|2018-04-03|Method for enhanced fermentation through the destruction of mitochondrial DNA in yeast
    CN109072262A|2018-12-21|For producing the improved biological method of aromatic yl acid ester
    CN104830748A|2015-08-12|Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli
    KR101326255B1|2013-11-11|Recombinant Microorganism Having Enhanced Productivity of 5-Aminolevulinic Acid and Method of Producing 5-aminolevulinic Acid Using the Same
    KR100332353B1|2002-09-13|Method for preparing ALA synthase-expressing Escherichia coli and biosynthetic delta-aminolevulinic acid using the same
    JP6778870B2|2020-11-04|Cyanobacteria mutant strain and succinic acid and D-lactic acid production method using it
    同族专利:
    公开号 | 公开日
    WO2020128117A8|2021-04-22|
    ES2772598B2|2021-04-12|
    WO2020128117A1|2020-06-25|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2020-07-07| BA2A| Patent application published|Ref document number: 2772598 Country of ref document: ES Kind code of ref document: A1 Effective date: 20200707 |
    2021-04-12| FG2A| Definitive protection|Ref document number: 2772598 Country of ref document: ES Kind code of ref document: B2 Effective date: 20210412 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201831274A|ES2772598B2|2018-12-21|2018-12-21|BIOTECHNOLOGICAL PRODUCTION OF D-DIBOA AND ITS CHLORINE DERIVATIVES FROM ITS NITROPHENOXIDE-ACETATE PRECURSORS|ES201831274A| ES2772598B2|2018-12-21|2018-12-21|BIOTECHNOLOGICAL PRODUCTION OF D-DIBOA AND ITS CHLORINE DERIVATIVES FROM ITS NITROPHENOXIDE-ACETATE PRECURSORS|
    PCT/ES2019/000074| WO2020128117A1|2018-12-21|2019-12-19|Biotechnological production of d-diboa and its chlorinated derivates from its nitrophenoxide-acetate precursors|
    [返回顶部]